BioLiP

>rna
aucgcuucucggccuuuuggcuaagaucaaguguaguaucuguucuuuuaauauguccucuaccgaggacaauauuaagg
auuuuuggagcagggagccacgcaucgaccugguauugcaguaccuccaggaacggugc

The query sequence (length=139) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	8i0w:H	139	139	1.0000	1.0000	1.0000	8.82e-70	5yzg:H
2	6icz:H	140	140	1.0000	0.9929	0.9929	4.10e-68	7w59:H, 7w5a:H, 7w5b:H, 5xjc:H
3	6id1:H	136	140	0.9712	0.9926	0.9643	2.49e-60
4	6id0:H	140	144	0.9712	0.9643	0.9375	9.01e-55
5	8ch6:f	137	142	0.8561	0.8686	0.8380	7.22e-31
6	5z56:H	136	142	0.8489	0.8676	0.8310	1.21e-28	5z57:H, 5z58:H
7	6ah0:H	109	71	0.4892	0.6239	0.9577	2.02e-26	6ahd:H, 8h6e:2A, 8h6j:2A, 8h6k:2A, 8h6l:2A
8	8c6j:2	142	153	0.8921	0.8732	0.8105	5.66e-22
9	5mqf:2	140	151	0.8777	0.8714	0.8079	7.32e-21
10	9fmd:2	120	140	0.8129	0.9417	0.8071	3.40e-19	6qdv:2
11	8i0r:H	167	47	0.3381	0.2814	1.0000	1.22e-18	8i0s:H, 8i0t:H, 8i0u:H
12	8i0r:H	167	42	0.3022	0.2515	1.0000	7.37e-16	8i0s:H, 8i0t:H, 8i0u:H
13	8i0p:H	165	45	0.3237	0.2727	1.0000	1.58e-17
14	8i0p:H	165	42	0.3022	0.2545	1.0000	7.37e-16
15	7abi:2	164	45	0.3237	0.2744	1.0000	1.58e-17
16	7abi:2	164	42	0.3022	0.2561	1.0000	7.37e-16
17	8i0v:H	151	44	0.3165	0.2914	1.0000	5.70e-17
18	8i0v:H	151	42	0.3022	0.2781	1.0000	7.37e-16
19	6ff4:2	60	43	0.3094	0.7167	1.0000	2.05e-16	6ff7:2
20	6y53:2	98	42	0.3022	0.4286	1.0000	7.37e-16
21	7vpx:H	130	42	0.3022	0.3231	1.0000	7.37e-16
22	5o9z:2	100	42	0.3022	0.4200	1.0000	7.37e-16
23	7evo:H	148	42	0.3022	0.2838	1.0000	7.37e-16	8hk1:H, 6y5q:2
24	7evo:H	148	29	0.2086	0.1959	1.0000	1.24e-08	8hk1:H, 6y5q:2
25	7abg:2	145	42	0.3022	0.2897	1.0000	7.37e-16
26	7a5p:2	155	42	0.3022	0.2710	1.0000	7.37e-16
27	8ro2:2	39	39	0.2806	1.0000	1.0000	3.43e-14
28	8r09:2	98	38	0.2734	0.3878	1.0000	1.23e-13	8r0b:2, 8rm5:2
29	8r08:2	97	38	0.2734	0.3918	1.0000	1.23e-13	8r0a:2
30	8qxd:2	97	38	0.2734	0.3918	1.0000	1.23e-13
31	6qx9:2	94	38	0.2734	0.4043	1.0000	1.23e-13
32	8qo9:2	98	38	0.2734	0.3878	1.0000	1.23e-13	8qzs:2
33	7qtt:f	76	47	0.3165	0.5789	0.9362	1.60e-12
34	6y50:2	50	29	0.2086	0.5800	1.0000	1.24e-08

[Back]