BioLiP

>rna
aucgcuucucggccuuuuggcuaagaucaaguguaguaucuguucuuuuaauaucguccucuaccgaggacaauauuaag
gauuuuuggagcagggaggcaucgaccugguauugcaguaccuccaggaacggugc

The query sequence (length=136) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	6id1:H	136	136	1.0000	1.0000	1.0000	4.00e-68
2	6id0:H	140	140	1.0000	0.9714	0.9714	1.45e-62
3	6icz:H	140	140	1.0000	0.9714	0.9714	1.45e-62	7w59:H, 7w5a:H, 7w5b:H, 5xjc:H
4	8i0w:H	139	140	0.9926	0.9712	0.9643	2.42e-60	5yzg:H
5	8ch6:f	137	150	0.9044	0.8978	0.8200	4.26e-23
6	9fmd:2	120	137	0.8235	0.9333	0.8175	5.51e-22	6qdv:2
7	5z56:H	136	150	0.8971	0.8971	0.8133	1.98e-21	5z57:H, 5z58:H
8	8i0r:H	167	47	0.3456	0.2814	1.0000	1.19e-18	8i0s:H, 8i0t:H, 8i0u:H
9	8i0r:H	167	38	0.2794	0.2275	1.0000	1.20e-13	8i0s:H, 8i0t:H, 8i0u:H
10	8c6j:2	142	47	0.3456	0.3310	1.0000	1.19e-18
11	8c6j:2	142	38	0.2794	0.2676	1.0000	1.20e-13
12	6ah0:H	109	71	0.4706	0.5872	0.9014	1.19e-18	6ahd:H, 8h6e:2A, 8h6j:2A, 8h6k:2A, 8h6l:2A
13	5mqf:2	140	45	0.3309	0.3214	1.0000	1.54e-17
14	5mqf:2	140	38	0.2794	0.2714	1.0000	1.20e-13
15	8i0p:H	165	45	0.3309	0.2727	1.0000	1.54e-17
16	8i0p:H	165	38	0.2794	0.2303	1.0000	1.20e-13
17	7abi:2	164	45	0.3309	0.2744	1.0000	1.54e-17
18	7abi:2	164	38	0.2794	0.2317	1.0000	1.20e-13
19	8i0v:H	151	44	0.3235	0.2914	1.0000	5.55e-17
20	8i0v:H	151	38	0.2794	0.2517	1.0000	1.20e-13
21	6ff4:2	60	43	0.3162	0.7167	1.0000	2.00e-16	6ff7:2
22	8ro2:2	39	39	0.2868	1.0000	1.0000	3.34e-14
23	6y53:2	98	38	0.2794	0.3878	1.0000	1.20e-13
24	7vpx:H	130	38	0.2794	0.2923	1.0000	1.20e-13
25	8r09:2	98	42	0.3015	0.4184	0.9762	1.20e-13	8r0b:2, 8rm5:2
26	8r08:2	97	42	0.3015	0.4227	0.9762	1.20e-13	8r0a:2
27	8qxd:2	97	42	0.3015	0.4227	0.9762	1.20e-13
28	6qx9:2	94	42	0.3015	0.4362	0.9762	1.20e-13
29	8qo9:2	98	42	0.3015	0.4184	0.9762	1.20e-13	8qzs:2
30	5o9z:2	100	38	0.2794	0.3800	1.0000	1.20e-13
31	7evo:H	148	38	0.2794	0.2568	1.0000	1.20e-13	8hk1:H, 6y5q:2
32	7evo:H	148	29	0.2132	0.1959	1.0000	1.21e-08	8hk1:H, 6y5q:2
33	7abg:2	145	38	0.2794	0.2621	1.0000	1.20e-13
34	7a5p:2	155	38	0.2794	0.2452	1.0000	1.20e-13
35	7qtt:f	76	47	0.3235	0.5789	0.9362	1.56e-12
36	6y50:2	50	29	0.2132	0.5800	1.0000	1.21e-08

[Back]