BioLiP

>rna
aucgcuucucggccuuuuggcuaagaucaaguguaguaucuguucuuaucauuaauaucguccucuaccgaggacaauau
uaaggauuuuuggagcagggaggcaucgaccugguauugcaguaccuccaggaacggugc

The query sequence (length=140) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	6id0:H	140	140	1.0000	1.0000	1.0000	2.47e-70
2	6id1:H	136	140	0.9714	1.0000	0.9714	1.50e-62
3	6icz:H	140	144	0.9714	0.9714	0.9444	5.43e-57	7w59:H, 7w5a:H, 7w5b:H, 5xjc:H
4	8i0w:H	139	144	0.9643	0.9712	0.9375	9.08e-55	5yzg:H
5	8ch6:f	137	150	0.9071	0.9270	0.8467	7.28e-31
6	5z56:H	136	150	0.9000	0.9265	0.8400	3.39e-29	5z57:H, 5z58:H
7	8i0r:H	167	61	0.4214	0.3533	0.9672	1.59e-22	8i0s:H, 8i0t:H, 8i0u:H
8	8i0r:H	167	38	0.2714	0.2275	1.0000	1.24e-13	8i0s:H, 8i0t:H, 8i0u:H
9	9fmd:2	120	60	0.4143	0.4833	0.9667	5.70e-22	6qdv:2
10	9fmd:2	120	38	0.2714	0.3167	1.0000	1.24e-13	6qdv:2
11	8c6j:2	142	60	0.4143	0.4085	0.9667	5.70e-22
12	8c6j:2	142	38	0.2714	0.2676	1.0000	1.24e-13
13	8i0p:H	165	59	0.4071	0.3455	0.9661	2.05e-21
14	8i0p:H	165	38	0.2714	0.2303	1.0000	1.24e-13
15	7abi:2	164	103	0.6286	0.5366	0.8544	2.05e-21
16	7abi:2	164	38	0.2714	0.2317	1.0000	1.24e-13
17	5mqf:2	140	58	0.4000	0.4000	0.9655	7.38e-21
18	5mqf:2	140	38	0.2714	0.2714	1.0000	1.24e-13
19	8i0v:H	151	61	0.4071	0.3775	0.9344	1.23e-18
20	8i0v:H	151	38	0.2714	0.2517	1.0000	1.24e-13
21	6ah0:H	109	71	0.4571	0.5872	0.9014	1.23e-18	6ahd:H, 8h6e:2A, 8h6j:2A, 8h6k:2A, 8h6l:2A
22	6ff4:2	60	59	0.3929	0.9167	0.9322	1.60e-17	6ff7:2
23	7qtt:f	76	61	0.4000	0.7368	0.9180	2.07e-16
24	8ro2:2	39	39	0.2786	1.0000	1.0000	3.46e-14
25	6y53:2	98	38	0.2714	0.3878	1.0000	1.24e-13
26	7vpx:H	130	38	0.2714	0.2923	1.0000	1.24e-13
27	8r09:2	98	42	0.2929	0.4184	0.9762	1.24e-13	8r0b:2, 8rm5:2
28	8r08:2	97	42	0.2929	0.4227	0.9762	1.24e-13	8r0a:2
29	8qxd:2	97	42	0.2929	0.4227	0.9762	1.24e-13
30	6qx9:2	94	42	0.2929	0.4362	0.9762	1.24e-13
31	8qo9:2	98	42	0.2929	0.4184	0.9762	1.24e-13	8qzs:2
32	5o9z:2	100	38	0.2714	0.3800	1.0000	1.24e-13
33	7evo:H	148	38	0.2714	0.2568	1.0000	1.24e-13	8hk1:H, 6y5q:2
34	7evo:H	148	43	0.2929	0.2770	0.9535	1.61e-12	8hk1:H, 6y5q:2
35	7abg:2	145	38	0.2714	0.2621	1.0000	1.24e-13
36	7a5p:2	155	38	0.2714	0.2452	1.0000	1.24e-13
37	6y50:2	50	43	0.2929	0.8200	0.9535	1.61e-12

[Back]