Home Research COVID-19 Services Publications People Teaching Job Opening News Forum --> -->
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
>rna
aucgcuucucggccuuuuggcuaagaucaaguguaguau

The query sequence (length=39) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 8ro2:2 39 39 1.0000 1.0000 1.0000 6.07e-15
2 6id1:H 136 39 1.0000 0.2868 1.0000 6.07e-15
3 6id0:H 140 39 1.0000 0.2786 1.0000 6.07e-15
4 6icz:H 140 39 1.0000 0.2786 1.0000 6.07e-15 7w59:H, 7w5a:H, 7w5b:H, 5xjc:H
5 8i0w:H 139 39 1.0000 0.2806 1.0000 6.07e-15 5yzg:H
6 8i0v:H 151 39 1.0000 0.2583 1.0000 6.07e-15
7 8i0r:H 167 39 1.0000 0.2335 1.0000 6.07e-15 8i0s:H, 8i0t:H, 8i0u:H
8 9fmd:2 120 39 1.0000 0.3250 1.0000 6.07e-15 6qdv:2
9 8c6j:2 142 39 1.0000 0.2746 1.0000 6.07e-15
10 5mqf:2 140 37 0.9487 0.2643 1.0000 7.86e-14
11 8i0p:H 165 37 0.9487 0.2242 1.0000 7.86e-14
12 6ff4:2 60 37 0.9487 0.6167 1.0000 7.86e-14 6ff7:2
13 7abi:2 164 37 0.9487 0.2256 1.0000 7.86e-14

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • yangzhanglabumich.edu | (734) 647-1549 | 100 Washtenaw Avenue, Ann Arbor, MI 48109-2218