auccuuaugcacgggaaauacgcauaucagugaggauucguccgagauuguguuuuugcugguugaa
The query sequence (length=67) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5nrl:4 | 114 | 67 | 1.0000 | 0.5877 | 1.0000 | 3.77e-30 | |
| 2 | 5gap:V | 67 | 67 | 1.0000 | 1.0000 | 1.0000 | 3.77e-30 | |
| 3 | 5gan:V | 124 | 67 | 1.0000 | 0.5403 | 1.0000 | 3.77e-30 | |
| 4 | 5zwm:I | 110 | 64 | 0.9552 | 0.5818 | 1.0000 | 1.75e-28 | 5zwo:I |
| 5 | 3jcm:E | 85 | 64 | 0.9552 | 0.7529 | 1.0000 | 1.75e-28 |
umich.edu