auccaugaccaaagaaucgucacaaaucgaagcuuacaaaauggaguaaaauuuuacucaguaauaugcuuuggguugaa
agucucccaccaauucguaugcggaaaacguaaugagauuuaaaaauaaaucaacucauuaaggaggaugccgguauucu
gcuucuugaccugguaccucuaggguacugguguucgguacuggauuccgauggaaucuaaaccauaguuaugacgauug
cucuuuccuggaucgaguaacccaauggagcuuacuauucuugguccauggauu
The query sequence (length=294) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6w6v:A | 294 | 294 | 1.0000 | 1.0000 | 1.0000 | 1.38e-155 | |
2 | 7c7a:A | 330 | 329 | 1.0000 | 0.8909 | 0.8936 | 1.15e-106 | |
3 | 7c79:A | 331 | 330 | 1.0000 | 0.8882 | 0.8909 | 1.49e-105 |