auacccgcuuaauucauucagaucuguaauagaacugucauucaaccccaaaaaucuagugcugauauaaccuucaccaa
uuagguucaaauaagugguaaugcgggacaaaagacuaucgacauuugauacacuauuuaucaauggaugucuuauuuu
The query sequence (length=159) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6d6v:B | 159 | 159 | 1.0000 | 1.0000 | 1.0000 | 7.85e-81 | 8gap:B |
2 | 7lma:B | 156 | 156 | 0.9811 | 1.0000 | 1.0000 | 3.65e-79 | 7uy5:B, 7uy6:B |
3 | 7lmb:B | 151 | 156 | 0.9497 | 1.0000 | 0.9679 | 3.71e-69 |