auaauuucuacuguuguagauagauuaaaagguaauucuauc
The query sequence (length=42) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5nfv:B | 42 | 42 | 1.0000 | 1.0000 | 1.0000 | 1.49e-16 | |
| 2 | 6i1k:B | 40 | 40 | 0.9524 | 1.0000 | 1.0000 | 1.93e-15 | 6i1l:B, 6i1l:E |
umich.edu