BioLiP

>rna
auaaagaugagacgcguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguga

The query sequence (length=77) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	7z4d:F	77	77	1.0000	1.0000	1.0000	1.26e-35
2	8t6t:B	95	76	0.9870	0.8000	1.0000	4.53e-35
3	7s4v:B	98	76	0.9870	0.7755	1.0000	4.53e-35	7s4x:B, 8spq:B, 8sqh:B, 8srs:B, 8t7s:B, 8tzz:B, 8u3y:B, 7z4j:A
4	7s4u:B	97	76	0.9870	0.7835	1.0000	4.53e-35
5	6o0z:B	96	76	0.9870	0.7917	1.0000	4.53e-35	8t6x:B, 7z4i:A, 7z4l:A
6	6o0x:B	98	76	0.9870	0.7755	1.0000	4.53e-35	6o0y:B
7	7z4d:A	75	75	0.9740	1.0000	1.0000	1.63e-34
8	8ye6:C	92	75	0.9740	0.8152	1.0000	1.63e-34	7z4h:A
9	7z4g:A	91	74	0.9610	0.8132	1.0000	5.85e-34
10	8t6s:B	90	73	0.9481	0.8111	1.0000	2.11e-33	7z4c:A
11	4zt0:B	72	71	0.9221	0.9861	1.0000	2.72e-32	4zt0:D, 4zt9:B, 4zt9:D
12	8t6p:B	88	71	0.9221	0.8068	1.0000	2.72e-32	8t76:B, 8t7s:H, 7z4e:A, 7z4k:A
13	8ye9:C	90	75	0.9481	0.8111	0.9733	1.27e-30
14	8t78:B	89	67	0.8701	0.7528	1.0000	4.56e-30
15	8t77:B	89	65	0.8442	0.7303	1.0000	5.90e-29	8t79:B
16	8t6y:B	88	65	0.8442	0.7386	1.0000	5.90e-29
17	7qr8:A	85	63	0.8182	0.7412	1.0000	7.63e-28
18	7qqw:A	81	63	0.8182	0.7778	1.0000	7.63e-28
19	7qqv:A	85	63	0.8182	0.7412	1.0000	7.63e-28
20	7qqs:A	84	63	0.8182	0.7500	1.0000	7.63e-28	7qqt:A, 7qqu:A, 7qqx:A, 7qqz:A, 7qr5:A
21	4oo8:B	97	63	0.8182	0.6495	1.0000	7.63e-28	4oo8:E
22	6ifo:D	90	63	0.8182	0.7000	1.0000	7.63e-28
23	6ifo:C	88	63	0.8182	0.7159	1.0000	7.63e-28	5xbl:B
24	6ai6:B	81	63	0.8182	0.7778	1.0000	7.63e-28	5b2r:A, 5b2s:A, 5b2t:A
25	7zo1:A	85	62	0.8052	0.7294	1.0000	2.74e-27
26	7qr1:A	83	62	0.8052	0.7470	1.0000	2.74e-27
27	7qr0:A	82	62	0.8052	0.7561	1.0000	2.74e-27
28	7qqq:A	83	62	0.8052	0.7470	1.0000	2.74e-27
29	7ox9:A	84	62	0.8052	0.7381	1.0000	2.74e-27	7qqo:A, 7qr7:A
30	7ox8:A	84	62	0.8052	0.7381	1.0000	2.74e-27
31	5fq5:A	83	62	0.8052	0.7470	1.0000	2.74e-27
32	8ygj:B	136	61	0.7922	0.4485	1.0000	9.87e-27
33	5y36:B	99	61	0.7922	0.6162	1.0000	9.87e-27
34	8wuv:B	126	61	0.7922	0.4841	1.0000	9.87e-27
35	8wuu:B	111	61	0.7922	0.5495	1.0000	9.87e-27
36	8wut:B	112	61	0.7922	0.5446	1.0000	9.87e-27
37	8wus:B	115	61	0.7922	0.5304	1.0000	9.87e-27
38	5vw1:C	73	61	0.7922	0.8356	1.0000	9.87e-27
39	6vpc:A	81	68	0.8571	0.8148	0.9706	9.87e-27
40	4un4:A	82	61	0.7922	0.7439	1.0000	9.87e-27	4un5:A
41	7s38:R	87	61	0.7922	0.7011	1.0000	9.87e-27
42	7s36:R	87	61	0.7922	0.7011	1.0000	9.87e-27	8t6o:B
43	7qqp:A	84	61	0.7922	0.7262	1.0000	9.87e-27	7qqr:A
44	7oxa:A	81	61	0.7922	0.7531	1.0000	9.87e-27
45	7ox7:A	81	61	0.7922	0.7531	1.0000	9.87e-27
46	8kal:E	95	61	0.7922	0.6421	1.0000	9.87e-27
47	8kak:A	94	61	0.7922	0.6489	1.0000	9.87e-27	8kak:E, 8kal:A, 8kam:A
48	8kag:A	98	61	0.7922	0.6224	1.0000	9.87e-27
49	6k4s:A	80	61	0.7922	0.7625	1.0000	9.87e-27	6k4u:A
50	6k4p:A	82	61	0.7922	0.7439	1.0000	9.87e-27
51	8g1i:B	98	61	0.7922	0.6224	1.0000	9.87e-27
52	5fw1:A	81	61	0.7922	0.7531	1.0000	9.87e-27	5fw2:A, 5fw3:A, 6k3z:A, 6k4q:A, 6k57:A, 4un3:A
53	6aeb:A	95	61	0.7922	0.6421	1.0000	9.87e-27	6aeb:E, 6aeg:A
54	7v59:C	115	46	0.5974	0.4000	1.0000	2.15e-18	7v59:G
55	8fzt:B	69	46	0.5974	0.6667	1.0000	2.15e-18
56	5f9r:A	116	46	0.5974	0.3966	1.0000	2.15e-18	6mcb:B, 6mcc:B, 5vzl:B
57	8kah:I	63	45	0.5844	0.7143	1.0000	7.73e-18	8kah:J, 8kai:I, 8kai:J, 8kaj:I, 8kaj:J

[Back]