auaaaccgacgguauuguucagauccuggcuugccaacaggaguuccccgcgccagcgggg
The query sequence (length=61) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5cd4:L | 61 | 61 | 1.0000 | 1.0000 | 1.0000 | 7.33e-27 | 5cd4:X, 5h9e:L, 5h9f:L, 4tvx:L |
| 2 | 4tvx:X | 60 | 61 | 0.9836 | 1.0000 | 0.9836 | 1.23e-24 |
umich.edu