aguucggccauccuacggcggaaacuccuuaacucguuccgaauuaagaagagaagcgccgucaggccccgccaguacug
cgaucggagacgucgugggaacacggggugccgaacc
The query sequence (length=117) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7pwg:3 | 117 | 117 | 1.0000 | 1.0000 | 1.0000 | 1.24e-57 | 7pwo:3 |
2 | 8fru:3 | 117 | 116 | 0.9915 | 0.9915 | 1.0000 | 4.44e-57 | |
3 | 8br8:LE | 117 | 116 | 0.9829 | 0.9829 | 0.9914 | 2.07e-55 | 8brm:LE, 8btd:LE, 8btr:LE |
4 | 8bsj:LE | 116 | 115 | 0.9744 | 0.9828 | 0.9913 | 7.43e-55 | |
5 | 8bsi:LE | 115 | 114 | 0.9658 | 0.9826 | 0.9912 | 2.67e-54 |