agugguaaugcgaaacacugccagguaacaaaucaauccucccacggugagcuuucuuuucaccauaauccaccuugggc
cuuuuaccgcguuguucggagcgggggcucaagauugaaaaaugcagcucuacguacuguugugaguucugcgcauuaac
gcaaaaaccuggggugu
The query sequence (length=177) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6az3:3 | 177 | 177 | 1.0000 | 1.0000 | 1.0000 | 8.74e-91 | |
2 | 8rxh:L3 | 183 | 184 | 0.9774 | 0.9454 | 0.9402 | 4.16e-74 | 8rxx:L3 |
3 | 5t2a:E | 169 | 177 | 0.9322 | 0.9763 | 0.9322 | 5.41e-68 | |
4 | 8a98:3 | 161 | 157 | 0.8362 | 0.9193 | 0.9427 | 1.96e-62 | |
5 | 8ova:BE | 188 | 186 | 0.9266 | 0.8723 | 0.8817 | 9.19e-56 | |
6 | 8a3w:3 | 153 | 108 | 0.6045 | 0.6993 | 0.9907 | 3.33e-50 | |
7 | 8ove:BE | 166 | 159 | 0.7910 | 0.8434 | 0.8805 | 2.00e-47 | |
8 | 8ovj:3 | 156 | 111 | 0.6045 | 0.6859 | 0.9640 | 2.59e-46 | |
9 | 5t5h:E | 146 | 108 | 0.5650 | 0.6849 | 0.9259 | 5.65e-38 | |
10 | 4v8m:BE | 210 | 210 | 0.9266 | 0.7810 | 0.7810 | 2.08e-22 | |
11 | 3jcs:3 | 184 | 194 | 0.8588 | 0.8261 | 0.7835 | 2.68e-21 |