agugauaaaccggacaguaucauggaccgguuuucccgguaauccguauuuacaagauugguuucacu
The query sequence (length=68) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8wt7:F | 68 | 68 | 1.0000 | 1.0000 | 1.0000 | 1.07e-30 | |
| 2 | 8wt8:F | 68 | 68 | 0.9706 | 0.9706 | 0.9706 | 2.32e-27 | 8wt9:F |
| 3 | 8wt6:F | 68 | 68 | 0.9706 | 0.9706 | 0.9706 | 2.32e-27 |
umich.edu