aguaaggucagcuaaauaagcuaucgggcccauaccccgaaaauguugguuauacccuucccguacuaccam
The query sequence (length=72) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8oip:AG | 72 | 71 | 0.9861 | 0.9861 | 1.0000 | 2.49e-32 | |
| 2 | 6gaw:AV | 71 | 71 | 0.9861 | 1.0000 | 1.0000 | 2.49e-32 | 6gaz:AV, 6gb2:AV, 7nqh:AV, 7nql:AV, 8oin:AG, 8oiq:AG, 8oir:AG, 8ois:AG, 8oit:AG, 7po2:5, 8qrn:5, 6ydp:AV, 6ydw:AV |
umich.edu