aggggcguaguucaauugguagagcaccgguuuccaaaaccggguguugggaguucgagucucuccgccccugcca
The query sequence (length=76) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8pkl:W | 76 | 76 | 1.0000 | 1.0000 | 1.0000 | 4.45e-35 | 8r3v:W, 8rcl:W, 8rcm:W, 8rcs:W, 8rct:W |
2 | 4v6n:BB | 76 | 76 | 0.9868 | 0.9868 | 0.9868 | 2.07e-33 | 4v6o:AB, 4v6p:AB, 4v6q:AB, 4v6r:AB |
3 | 4v5r:AY | 77 | 76 | 0.9868 | 0.9740 | 0.9868 | 2.07e-33 | 4v5r:CY |
4 | 4v5p:AY | 77 | 76 | 0.9737 | 0.9610 | 0.9737 | 9.63e-32 | 4v5p:CY |
5 | 4v5l:AY | 77 | 76 | 0.9737 | 0.9610 | 0.9737 | 9.63e-32 | 4v5q:AY, 4v5q:CY, 4v5s:AY, 4v5s:CY |
6 | 4ycp:B | 62 | 65 | 0.8158 | 1.0000 | 0.9538 | 7.55e-23 |