aggauaagugcauuauguuuauguggugauuugcccuucuguagcca
The query sequence (length=47) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 3ja1:S1 | 47 | 47 | 1.0000 | 1.0000 | 1.0000 | 3.00e-19 | 4v6n:BC, 4v6o:AC, 4v6p:AC, 4v6q:AC, 4v6r:AC, 4v6s:BB, 4v6v:A2 |
umich.edu