agcuuugcgcaguggcaguaucguagccaaugaggucuauccgaggcgcgauuugcuaauugaaaacuucccaauagccg
ugacgacuagucggcacuggcaauuuuugacagucucgagacugg
The query sequence (length=125) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8h6e:4A | 125 | 125 | 1.0000 | 1.0000 | 1.0000 | 4.72e-62 | |
2 | 8qxd:4 | 124 | 124 | 0.9920 | 1.0000 | 1.0000 | 1.70e-61 | 8r08:4, 8r0a:4 |
3 | 8h6j:4A | 125 | 125 | 0.9920 | 0.9920 | 0.9920 | 7.89e-60 | |
4 | 6qw6:4 | 125 | 125 | 0.9840 | 0.9840 | 0.9840 | 1.02e-58 | 6qx9:4 |
5 | 8r09:4 | 128 | 128 | 0.9920 | 0.9688 | 0.9688 | 6.15e-56 | 8r0b:4 |
6 | 8qo9:4 | 127 | 130 | 0.9440 | 0.9291 | 0.9077 | 4.85e-42 | |
7 | 8qp8:4 | 76 | 76 | 0.6080 | 1.0000 | 1.0000 | 8.18e-35 | 8qp9:4, 8qpk:4 |
8 | 8rm5:4 | 110 | 124 | 0.8800 | 1.0000 | 0.8871 | 2.94e-34 | |
9 | 6ahd:I | 136 | 138 | 0.9520 | 0.8750 | 0.8623 | 3.80e-33 | 8qzs:4 |
10 | 5o9z:4 | 137 | 139 | 0.9440 | 0.8613 | 0.8489 | 2.29e-30 | |
11 | 8qoz:4 | 80 | 80 | 0.6080 | 0.9500 | 0.9500 | 2.96e-29 | 8qpb:4 |
12 | 8h6k:4A | 128 | 134 | 0.9120 | 0.8906 | 0.8507 | 2.96e-29 | 8h6l:4A |
13 | 6ah0:I | 117 | 125 | 0.8400 | 0.8974 | 0.8400 | 6.41e-26 | |
14 | 8qpe:4 | 63 | 63 | 0.4880 | 0.9683 | 0.9683 | 1.07e-23 | |
15 | 8qpa:4 | 62 | 62 | 0.4800 | 0.9677 | 0.9677 | 3.86e-23 | |
16 | 8q7n:4 | 76 | 62 | 0.4720 | 0.7763 | 0.9516 | 1.80e-21 |