agcuuugcgcaguggcaguaucguagccaaugaggucuauccgaggcgcgauuauugcuaauuacuuuucccaauacccc
gccgugacgacuugcaauauagucggcacuggcaauuuuugacagucucgagacug
The query sequence (length=136) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6ahd:I | 136 | 136 | 1.0000 | 1.0000 | 1.0000 | 4.00e-68 | 8qzs:4 |
2 | 5o9z:4 | 137 | 136 | 0.9853 | 0.9781 | 0.9853 | 8.66e-65 | |
3 | 8h6k:4A | 128 | 136 | 0.9412 | 1.0000 | 0.9412 | 1.47e-52 | 8h6l:4A |
4 | 8qo9:4 | 127 | 136 | 0.9338 | 1.0000 | 0.9338 | 2.46e-50 | |
5 | 8r09:4 | 128 | 140 | 0.9118 | 0.9688 | 0.8857 | 3.23e-39 | 8r0b:4 |
6 | 8h6j:4A | 125 | 138 | 0.8824 | 0.9600 | 0.8696 | 9.03e-35 | |
7 | 8qxd:4 | 124 | 138 | 0.8750 | 0.9597 | 0.8623 | 4.20e-33 | 8r08:4, 8r0a:4 |
8 | 8h6e:4A | 125 | 138 | 0.8750 | 0.9520 | 0.8623 | 4.20e-33 | |
9 | 8q7n:4 | 76 | 77 | 0.5515 | 0.9868 | 0.9740 | 1.96e-31 | |
10 | 6qw6:4 | 125 | 138 | 0.8603 | 0.9360 | 0.8478 | 9.10e-30 | 6qx9:4 |
11 | 8qoz:4 | 80 | 80 | 0.5588 | 0.9500 | 0.9500 | 3.27e-29 | 8qpb:4 |
12 | 6ah0:I | 117 | 136 | 0.8529 | 0.9915 | 0.8529 | 3.27e-29 | |
13 | 8qpe:4 | 63 | 63 | 0.4632 | 1.0000 | 1.0000 | 1.52e-27 | |
14 | 8rm5:4 | 110 | 62 | 0.4559 | 0.5636 | 1.0000 | 5.48e-27 | |
15 | 8rm5:4 | 110 | 37 | 0.2721 | 0.3364 | 1.0000 | 4.32e-13 | |
16 | 8qpa:4 | 62 | 62 | 0.4559 | 1.0000 | 1.0000 | 5.48e-27 | |
17 | 8qp8:4 | 76 | 63 | 0.4485 | 0.8026 | 0.9683 | 1.19e-23 | 8qp9:4, 8qpk:4 |