Home Research COVID-19 Services Publications People Teaching Job Opening News Forum --> -->
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
>rna
agcuuugcgcaguggcaguaucguagccaaugaggucuauccgaggcgcgauuauugcuaau

The query sequence (length=62) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 8rm5:4 110 62 1.0000 0.5636 1.0000 2.08e-27
2 8r09:4 128 62 1.0000 0.4844 1.0000 2.08e-27 8r0b:4
3 8qpe:4 63 62 1.0000 0.9841 1.0000 2.08e-27
4 8qpa:4 62 62 1.0000 1.0000 1.0000 2.08e-27
5 8qoz:4 80 62 1.0000 0.7750 1.0000 2.08e-27 8qpb:4
6 8qo9:4 127 62 1.0000 0.4882 1.0000 2.08e-27
7 8h6k:4A 128 62 1.0000 0.4844 1.0000 2.08e-27 8h6l:4A
8 6ahd:I 136 62 1.0000 0.4559 1.0000 2.08e-27 8qzs:4
9 8q7n:4 76 62 0.9839 0.8026 0.9839 9.70e-26
10 5o9z:4 137 62 0.9839 0.4453 0.9839 9.70e-26
11 8h6j:4A 125 62 0.9839 0.4880 0.9839 3.49e-25
12 8qxd:4 124 62 0.9677 0.4839 0.9677 1.62e-23 8r08:4, 8r0a:4
13 8qp8:4 76 62 0.9677 0.7895 0.9677 1.62e-23 8qp9:4, 8qpk:4
14 8h6e:4A 125 62 0.9677 0.4800 0.9677 1.62e-23
15 6qw6:4 125 62 0.9516 0.4720 0.9516 7.55e-22 6qx9:4
16 6ah0:I 117 53 0.8226 0.4359 0.9623 1.63e-18

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • yangzhanglabumich.edu | (734) 647-1549 | 100 Washtenaw Avenue, Ann Arbor, MI 48109-2218