agcuuugcgcaguggcaaucguagccaaugaggucuauccgaggcgcgauugcuaauugccgccgugacgacuugcaaua
uagucggcacuggcaauuuuugacagucucgagacug
The query sequence (length=117) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6ah0:I | 117 | 117 | 1.0000 | 1.0000 | 1.0000 | 1.24e-57 | |
2 | 8h6k:4A | 128 | 128 | 0.9915 | 0.9062 | 0.9062 | 2.11e-40 | 8h6l:4A |
3 | 6ahd:I | 136 | 136 | 0.9915 | 0.8529 | 0.8529 | 2.77e-29 | 8qzs:4 |
4 | 8rm5:4 | 110 | 122 | 0.8974 | 0.9545 | 0.8607 | 4.63e-27 | |
5 | 8qxd:4 | 124 | 125 | 0.8974 | 0.8468 | 0.8400 | 6.00e-26 | 8r08:4, 8r0a:4 |
6 | 5o9z:4 | 137 | 136 | 0.9744 | 0.8321 | 0.8382 | 6.00e-26 | |
7 | 8h6e:4A | 125 | 125 | 0.8974 | 0.8400 | 0.8400 | 6.00e-26 | |
8 | 8h6j:4A | 125 | 126 | 0.8974 | 0.8400 | 0.8333 | 7.76e-25 | |
9 | 8r09:4 | 128 | 128 | 0.8974 | 0.8203 | 0.8203 | 4.67e-22 | 8r0b:4 |
10 | 8qo9:4 | 127 | 128 | 0.8974 | 0.8268 | 0.8203 | 4.67e-22 | |
11 | 8qp8:4 | 76 | 62 | 0.5043 | 0.7763 | 0.9516 | 6.04e-21 | 8qp9:4, 8qpk:4 |
12 | 8qpe:4 | 63 | 53 | 0.4359 | 0.8095 | 0.9623 | 3.63e-18 | |
13 | 8qpa:4 | 62 | 53 | 0.4359 | 0.8226 | 0.9623 | 3.63e-18 | |
14 | 8qoz:4 | 80 | 64 | 0.5043 | 0.7375 | 0.9219 | 3.63e-18 | 8qpb:4 |