agcgccguggcgcaguggaagcgcgcaggucucauaaaccugauguccucggaucgaaaccgagcggcgcuacca
The query sequence (length=75) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6gsn:1 | 75 | 75 | 1.0000 | 1.0000 | 1.0000 | 1.57e-34 | 3jap:1 |
| 2 | 3j81:1 | 74 | 74 | 0.9867 | 1.0000 | 1.0000 | 5.65e-34 | |
| 3 | 8cas:1 | 75 | 75 | 0.9733 | 0.9733 | 0.9733 | 3.40e-31 | 6fyx:1, 6fyy:1, 8k82:C5, 5oa3:1, 8rw1:1, 8s8d:1, 8s8e:1, 8s8f:1, 8s8g:1, 8s8h:1, 8s8i:1, 8s8j:1, 6tb3:n, 6tnu:n, 6zu9:1 |
| 4 | 6gsm:1 | 74 | 74 | 0.9600 | 0.9730 | 0.9730 | 1.22e-30 | |
| 5 | 6woo:3 | 76 | 76 | 0.9733 | 0.9605 | 0.9605 | 1.58e-29 | |
| 6 | 7b7d:Sn | 75 | 75 | 0.9600 | 0.9600 | 0.9600 | 1.58e-29 | 7nrc:Sn, 7nrd:Sn |
umich.edu