agcagaguagcgcagcggaagcgugcugggcccauaacccagaggucgauggaucgaaaccauccucugcuacca
The query sequence (length=75) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7a09:f | 75 | 75 | 1.0000 | 1.0000 | 1.0000 | 1.57e-34 | 6zp4:1 |
| 2 | 8bsi:Lu | 75 | 75 | 0.9867 | 0.9867 | 0.9867 | 7.31e-33 | 8bsj:u, 8bsj:v, 8btd:u, 8btr:u, 7cpu:S6, 7cpv:S6, 6fec:N, 6hcj:33, 6hcq:33, 5k0y:N, 8k2c:CC, 4kzz:j, 7ls1:n2, 7ls2:n2, 8oz0:y, 8p03:1, 8p09:1, 8pj1:w, 8pj2:w, 8pj3:w, 8pj4:w, 8pj5:w, 8ppl:Iw, 7qp6:w, 7qp7:w, 7qvp:B5, 6qzp:S6, 7syr:i, 7sys:i, 7syv:i, 7syw:i, 7syx:i, 5t2c:An, 7tql:3, 4ug0:S6, 4v6x:BC, 8xsx:CC, 8xsz:CC, 8xsz:CD, 6y57:B4, 6yal:1, 6yam:1, 6yan:1, 6ybv:w, 6zmw:w |
| 3 | 8pj6:w | 73 | 73 | 0.9600 | 0.9863 | 0.9863 | 9.46e-32 | |
| 4 | 8btd:v | 75 | 75 | 0.9600 | 0.9600 | 0.9600 | 1.58e-29 | 8btr:v |
| 5 | 7ucj:2 | 72 | 75 | 0.9333 | 0.9722 | 0.9333 | 4.43e-25 | |
| 6 | 8xsy:CC | 69 | 75 | 0.9067 | 0.9855 | 0.9067 | 3.45e-21 | |
| 7 | 8br8:Lu | 57 | 33 | 0.4400 | 0.5789 | 1.0000 | 3.50e-11 |
umich.edu