Home Research COVID-19 Services Publications People Teaching Job Opening News Forum --> -->
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
>rna
agaguguagcuuaacacaaagcacccaacuuacacuuaggagauucaauugacgcucuga

The query sequence (length=60) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 6i9r:B 60 60 1.0000 1.0000 1.0000 2.57e-26 7o9k:B, 7o9m:B
2 7og4:XB 59 60 0.9833 1.0000 0.9833 4.31e-24 6zs9:XB, 6zsa:XB, 6zsb:XB, 6zsc:XB, 6zsd:XB, 6zse:XB, 6zsg:XB
3 3j7y:B 57 60 0.9333 0.9825 0.9333 1.56e-18
4 7a5f:B3 56 60 0.9333 1.0000 0.9333 1.56e-18 7a5g:B3, 7a5h:B, 7a5i:B3, 7a5j:B, 7a5k:B3, 3j9m:B, 8k2a:L2, 8k2b:L2, 7l08:B, 7l20:B, 6nu2:B, 6nu3:B, 7of0:B, 7of2:B, 7of3:B, 7of4:B, 7of5:B, 7of6:B, 7of7:B, 7oi6:B, 7oi7:B, 7oi8:B, 7oi9:B, 7oia:B, 7oib:B, 7oic:B, 7oid:B, 7oie:B, 5ool:B, 5oom:B, 7qh6:B, 7qh7:B, 8qu1:B, 8qu5:B, 6vlz:B, 6vmi:B, 8xt0:L2, 8xt1:L2, 8xt2:L2, 8xt3:L2
5 8any:B 72 49 0.8000 0.6667 0.9796 5.61e-18 7odr:B, 7ods:B, 7odt:B, 8oir:B9, 8oit:B9, 8pk0:B, 7po4:B, 7qi4:B, 7qi5:B, 7qi6:B, 8qsj:B, 6zm5:B, 6zm6:B

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • yangzhanglabumich.edu | (734) 647-1549 | 100 Washtenaw Avenue, Ann Arbor, MI 48109-2218