agaguguagcuuaaaagcacccaacuuacacuuaggagauucaauugacgcucuga
The query sequence (length=56) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 3j7y:B | 57 | 56 | 1.0000 | 0.9825 | 1.0000 | 3.90e-24 | |
2 | 7a5f:B3 | 56 | 56 | 1.0000 | 1.0000 | 1.0000 | 3.90e-24 | 7a5g:B3, 7a5h:B, 7a5i:B3, 7a5j:B, 7a5k:B3, 3j9m:B, 8k2a:L2, 8k2b:L2, 7l08:B, 7l20:B, 6nu2:B, 6nu3:B, 7of0:B, 7of2:B, 7of3:B, 7of4:B, 7of5:B, 7of6:B, 7of7:B, 7oi6:B, 7oi7:B, 7oi8:B, 7oi9:B, 7oia:B, 7oib:B, 7oic:B, 7oid:B, 7oie:B, 5ool:B, 5oom:B, 7qh6:B, 7qh7:B, 8qu1:B, 8qu5:B, 6vlz:B, 6vmi:B, 8xt0:L2, 8xt1:L2, 8xt2:L2, 8xt3:L2 |
3 | 7og4:XB | 59 | 59 | 1.0000 | 0.9492 | 0.9492 | 1.09e-19 | 6zs9:XB, 6zsa:XB, 6zsb:XB, 6zsc:XB, 6zsd:XB, 6zse:XB, 6zsg:XB |
4 | 6i9r:B | 60 | 60 | 1.0000 | 0.9333 | 0.9333 | 1.41e-18 | 7o9k:B, 7o9m:B |
5 | 8any:B | 72 | 49 | 0.7857 | 0.6111 | 0.8980 | 3.08e-10 | 7odr:B, 7ods:B, 7odt:B, 8oir:B9, 8oit:B9, 8pk0:B, 7po4:B, 7qi4:B, 7qi5:B, 7qi6:B, 8qsj:B, 6zm5:B, 6zm6:B |