agagcacuuuuaucaccguguccccaaucuggauauuuugugug
The query sequence (length=44) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8ip0:F | 44 | 44 | 1.0000 | 1.0000 | 1.0000 | 1.25e-17 | |
| 2 | 8h7q:D | 36 | 36 | 0.8182 | 1.0000 | 1.0000 | 3.50e-13 | |
| 3 | 8h67:B | 38 | 38 | 0.8409 | 0.9737 | 0.9737 | 4.53e-12 |
umich.edu