agagacuugggcaaugugacugcugaucagcagucacauugcccaagucucuu
The query sequence (length=53) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7w0e:C | 53 | 53 | 1.0000 | 1.0000 | 1.0000 | 1.67e-22 | |
2 | 7w0e:C | 53 | 52 | 0.9811 | 0.9811 | 1.0000 | 6.01e-22 | |
3 | 7w0d:D | 52 | 52 | 0.9811 | 1.0000 | 1.0000 | 6.01e-22 | 7w0d:C, 7w0e:D |
4 | 7w0d:D | 52 | 51 | 0.9623 | 0.9808 | 1.0000 | 2.16e-21 | 7w0d:C, 7w0e:D |
5 | 8hf0:N | 50 | 50 | 0.9434 | 1.0000 | 1.0000 | 7.77e-21 | |
6 | 8hf0:N | 50 | 49 | 0.9245 | 0.9800 | 1.0000 | 2.79e-20 | |
7 | 8hf0:P | 47 | 47 | 0.8868 | 1.0000 | 1.0000 | 3.61e-19 | |
8 | 8hf0:P | 47 | 47 | 0.8868 | 1.0000 | 1.0000 | 3.61e-19 | |
9 | 7w0c:D | 37 | 37 | 0.6981 | 1.0000 | 1.0000 | 1.31e-13 | |
10 | 7w0c:D | 37 | 36 | 0.6792 | 0.9730 | 1.0000 | 4.71e-13 | |
11 | 7w0c:C | 35 | 35 | 0.6604 | 1.0000 | 1.0000 | 1.69e-12 | |
12 | 7w0c:C | 35 | 35 | 0.6604 | 1.0000 | 1.0000 | 1.69e-12 | |
13 | 7w0a:D | 32 | 32 | 0.6038 | 1.0000 | 1.0000 | 7.88e-11 | 7w0a:H |
14 | 7w0a:D | 32 | 31 | 0.5849 | 0.9688 | 1.0000 | 2.83e-10 | 7w0a:H |
15 | 7w0a:C | 31 | 31 | 0.5849 | 1.0000 | 1.0000 | 2.83e-10 | 7w0a:G |
16 | 7w0a:C | 31 | 31 | 0.5849 | 1.0000 | 1.0000 | 2.83e-10 | 7w0a:G |