BioLiP

>rna
acucugguuucucuucagaucgcauaaaucuuucgccuuuuacuaaagauuuccguggagaggaacaacucugagucuuc
caauuuuuugaggccuugcuuuggcaaggcua

The query sequence (length=112) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	8r09:5	112	112	1.0000	1.0000	1.0000	7.05e-55	8r0b:5, 8rm5:5
2	6ah0:B	115	115	1.0000	0.9739	0.9739	1.98e-50	6ahd:B, 8h6k:5A, 8h6l:5A, 8q7n:5, 8qo9:5, 8qpe:5, 8r0a:5
3	8h6e:5A	114	114	0.9911	0.9737	0.9737	7.10e-50	8h6j:5A
4	8qzs:5	109	112	0.9732	1.0000	0.9732	9.19e-49	8y6o:B
5	7abg:5	114	115	0.9821	0.9649	0.9565	4.28e-47	7abi:5, 5mqf:5, 5o9z:5
6	8c6j:5	113	114	0.9732	0.9646	0.9561	1.54e-46
7	6id0:B	98	98	0.8482	0.9694	0.9694	5.57e-41	6id1:B
8	6icz:B	97	97	0.8393	0.9691	0.9691	2.00e-40
9	8q7q:5	104	112	0.9286	1.0000	0.9286	2.59e-39	8q7v:5, 8q7w:5, 8q7x:5, 8q91:5, 6qw6:5, 6qx9:5, 8qxd:5, 8r08:5, 8rc0:5
10	8qoz:5	79	79	0.7054	1.0000	1.0000	1.56e-36	8qpa:5, 8qpb:5
11	8ch6:e	98	106	0.8750	1.0000	0.9245	5.61e-36	7qtt:e
12	8qpk:5	77	77	0.6875	1.0000	1.0000	2.02e-35
13	8i0p:B	98	107	0.8750	1.0000	0.9159	2.61e-34	8i0r:B, 8i0s:B, 8i0t:B, 8i0u:B, 8i0v:B, 8i0w:B
14	6zym:5	74	74	0.6607	1.0000	1.0000	9.39e-34
15	6ff4:5	70	70	0.6250	1.0000	1.0000	1.57e-31	6ff7:5
16	7aav:5	69	69	0.6161	1.0000	1.0000	5.65e-31
17	7w59:B	84	64	0.5714	0.7619	1.0000	3.40e-28	7w5a:B, 7w5b:B, 5xjc:B, 5yzg:B, 5z56:B, 5z57:B, 5z58:B
18	7dvq:B	90	64	0.5714	0.7111	1.0000	3.40e-28
19	6qdv:5	75	63	0.5625	0.8400	1.0000	1.22e-27
20	9fmd:5	92	61	0.5446	0.6630	1.0000	1.58e-26	8ro2:5
21	8qp8:5	71	76	0.6339	1.0000	0.9342	7.36e-25	8qp9:5
22	7abf:5	58	58	0.5179	1.0000	1.0000	7.36e-25
23	8ro1:5	111	52	0.4107	0.4144	0.8846	5.81e-11
24	8ro0:5	111	52	0.4107	0.4144	0.8846	5.81e-11

[Back]