BioLiP

>rna
acucugguuucucuucagaucgcauaaaucuuucgccuuuuacuaaagauuuccguggagaggaacaacucugagucuu

The query sequence (length=79) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	8r09:5	112	79	1.0000	0.7054	1.0000	1.01e-36	8r0b:5, 8rm5:5
2	8qoz:5	79	79	1.0000	1.0000	1.0000	1.01e-36	8qpa:5, 8qpb:5
3	8c6j:5	113	79	1.0000	0.6991	1.0000	1.01e-36
4	6ah0:B	115	79	1.0000	0.6870	1.0000	1.01e-36	6ahd:B, 8h6k:5A, 8h6l:5A, 8q7n:5, 8qo9:5, 8qpe:5, 8r0a:5
5	7abg:5	114	79	1.0000	0.6930	1.0000	1.01e-36	7abi:5, 5mqf:5, 5o9z:5
6	8h6e:5A	114	78	0.9873	0.6842	1.0000	3.62e-36	8h6j:5A
7	8qzs:5	109	77	0.9747	0.7064	1.0000	1.30e-35	8y6o:B
8	8qpk:5	77	77	0.9747	1.0000	1.0000	1.30e-35
9	6id0:B	98	75	0.9494	0.7653	1.0000	1.68e-34	6id1:B
10	6zym:5	74	74	0.9367	1.0000	1.0000	6.06e-34
11	6icz:B	97	74	0.9367	0.7629	1.0000	6.06e-34
12	6ff4:5	70	70	0.8861	1.0000	1.0000	1.01e-31	6ff7:5
13	7aav:5	69	69	0.8734	1.0000	1.0000	3.64e-31
14	8ch6:e	98	70	0.8734	0.7041	0.9857	1.70e-29	7qtt:e
15	7w59:B	84	64	0.8101	0.7619	1.0000	2.19e-28	7w5a:B, 7w5b:B, 5xjc:B, 5yzg:B, 5z56:B, 5z57:B, 5z58:B
16	8i0p:B	98	64	0.8101	0.6531	1.0000	2.19e-28	8i0r:B, 8i0s:B, 8i0t:B, 8i0u:B, 8i0v:B, 8i0w:B
17	7dvq:B	90	64	0.8101	0.7111	1.0000	2.19e-28
18	6qdv:5	75	63	0.7975	0.8400	1.0000	7.89e-28
19	9fmd:5	92	61	0.7722	0.6630	1.0000	1.02e-26	8ro2:5
20	8q7q:5	104	77	0.9114	0.6923	0.9351	1.32e-25	8q7v:5, 8q7w:5, 8q7x:5, 8q91:5, 6qw6:5, 6qx9:5, 8qxd:5, 8r08:5, 8rc0:5
21	8qp8:5	71	76	0.8987	1.0000	0.9342	4.75e-25	8qp9:5
22	7abf:5	58	58	0.7342	1.0000	1.0000	4.75e-25
23	8ro1:5	111	52	0.5823	0.4144	0.8846	3.75e-11
24	8ro0:5	111	52	0.5823	0.4144	0.8846	3.75e-11

[Back]