acguacgaccauacccaguggaaagcacggcaucccguccgcucugcccuaguuaagccacugagggcccgguuaguagu
ugggucgggaccagcgaaucccggguguuguacgu
The query sequence (length=115) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8pv6:C4 | 115 | 115 | 1.0000 | 1.0000 | 1.0000 | 1.56e-56 | 8pv8:C4 |
| 2 | 8i9r:C4 | 119 | 119 | 1.0000 | 0.9664 | 0.9664 | 5.67e-51 | 7ozs:3, 8pv1:C4, 8pv2:C4, 8pv3:C4, 8pv4:C4, 8pv5:C4, 8pv7:C4, 8pvk:C4, 8pvl:C4 |
umich.edu