acggaaacuuaaaaccguguugcacugcaacccggaauucuugcacgucg
The query sequence (length=50) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8wfx:O | 50 | 50 | 1.0000 | 1.0000 | 1.0000 | 7.10e-21 | |
| 2 | 8x5d:O | 47 | 47 | 0.9400 | 1.0000 | 1.0000 | 3.30e-19 |
umich.edu