acggaaacgcuuucuagcucgcuauaauuacc
The query sequence (length=32) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6ifn:N | 32 | 32 | 1.0000 | 1.0000 | 1.0000 | 3.38e-11 | |
| 2 | 6ifl:I | 35 | 32 | 1.0000 | 0.9143 | 1.0000 | 3.38e-11 | 6ifr:N |
| 3 | 6ifk:N | 34 | 32 | 1.0000 | 0.9412 | 1.0000 | 3.38e-11 | 6ifu:I, 6ify:I, 6ifz:I, 6ig0:N |
| 4 | 6ifl:J | 35 | 31 | 0.9688 | 0.8857 | 1.0000 | 1.22e-10 | 6ifr:J |
umich.edu