BioLiP

>rna
acgauacagagaagauuagcauggccccugcgcaaggaugacauucgugaagcguauuu

The query sequence (length=59) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	8rm5:6	64	59	1.0000	0.9219	1.0000	9.04e-26
2	8r09:6	65	59	1.0000	0.9077	1.0000	9.04e-26	8r0b:6
3	8h6k:6A	60	59	1.0000	0.9833	1.0000	9.04e-26
4	8h6e:6A	59	59	1.0000	1.0000	1.0000	9.04e-26	8h6l:6A, 8qzs:6
5	6ahd:F	94	59	1.0000	0.6277	1.0000	9.04e-26	8qo9:6
6	5o9z:6	90	55	0.9322	0.6111	1.0000	1.51e-23
7	5z56:F	93	57	0.9322	0.5914	0.9649	9.10e-21	5z57:F, 5z58:F
8	8h6j:6A	54	51	0.8475	0.9259	0.9804	1.18e-19
9	8ch6:d	93	57	0.9153	0.5806	0.9474	4.23e-19	7qtt:d
10	8r0a:6	59	56	0.8983	0.8983	0.9464	5.48e-18
11	6zym:6	79	43	0.7288	0.5443	1.0000	7.09e-17
12	8qpe:6	43	43	0.7288	1.0000	1.0000	7.09e-17
13	8qpa:6	47	43	0.7288	0.9149	1.0000	7.09e-17
14	8qoz:6	48	43	0.7288	0.8958	1.0000	7.09e-17	8qpb:6
15	8q7n:6	78	43	0.7288	0.5513	1.0000	7.09e-17
16	5mqf:6	89	43	0.7288	0.4831	1.0000	7.09e-17
17	6ff4:6	95	43	0.7288	0.4526	1.0000	7.09e-17	6ff7:6, 8i0p:F
18	8c6j:6	97	43	0.7288	0.4433	1.0000	7.09e-17	9fmd:6, 8i0r:F, 8i0s:F, 8i0t:F, 8i0u:F, 8i0v:F, 8i0w:F, 6icz:F, 6id0:F, 6id1:F, 6qdv:6, 8ro2:6, 7w59:F, 7w5a:F, 7w5b:F, 5xjc:F, 5yzg:F
19	6ah0:F	69	53	0.8475	0.7246	0.9434	7.09e-17
20	6qx9:6	53	51	0.8136	0.9057	0.9412	9.17e-16	8qxd:6, 8r08:6
21	8ro1:6	101	43	0.7119	0.4158	0.9767	3.30e-15
22	8ro0:6	90	43	0.7119	0.4667	0.9767	3.30e-15
23	3jb9:N	90	43	0.7119	0.4667	0.9767	3.30e-15
24	8qpk:6	43	38	0.6441	0.8837	1.0000	4.26e-14
25	6qw6:6	42	37	0.6102	0.8571	0.9730	7.14e-12
26	8qp8:6	37	34	0.5593	0.8919	0.9706	3.32e-10	8qp9:6

[Back]