acgaaucucuuugccuuuuggcuuagaucaaguguaguaucuguucuuuucauguaacaacuaaugaccucagaggcuca
auuuguuacaauacacauuuuuuggcacccaaaauaggacgggaagagacuuuuaaagugagacgucgcgacccucgcag
gagucguucuugacuuuuuggucgcuugauguuucucucuucccguuc
The query sequence (length=208) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6j6g:L | 208 | 208 | 1.0000 | 1.0000 | 1.0000 | 6.13e-108 | |
2 | 6j6h:L | 209 | 209 | 1.0000 | 0.9952 | 0.9952 | 2.85e-106 | |
3 | 6j6q:L | 210 | 210 | 1.0000 | 0.9905 | 0.9905 | 3.69e-105 | |
4 | 6j6n:L | 205 | 209 | 0.9712 | 0.9854 | 0.9665 | 3.74e-95 | |
5 | 7b9v:2 | 196 | 216 | 0.8846 | 0.9388 | 0.8519 | 3.99e-50 | |
6 | 5gmk:L | 127 | 109 | 0.4952 | 0.8110 | 0.9450 | 3.12e-41 | |
7 | 5lj3:Z | 171 | 208 | 0.8125 | 0.9883 | 0.8125 | 8.81e-32 | 5lj5:Z |
8 | 5lqw:2 | 81 | 81 | 0.3654 | 0.9383 | 0.9383 | 2.47e-27 | |
9 | 7dco:H | 169 | 73 | 0.3365 | 0.4142 | 0.9589 | 8.87e-27 | |
10 | 5gm6:L | 66 | 63 | 0.2981 | 0.9394 | 0.9841 | 4.13e-25 | |
11 | 5wsg:L | 91 | 52 | 0.2500 | 0.5714 | 1.0000 | 3.21e-21 | 5ylz:F |
12 | 5mq0:2 | 155 | 91 | 0.3846 | 0.5161 | 0.8791 | 3.21e-21 | |
13 | 5mps:2 | 49 | 49 | 0.2356 | 1.0000 | 1.0000 | 1.50e-19 | |
14 | 6exn:2 | 136 | 61 | 0.2740 | 0.4191 | 0.9344 | 1.93e-18 | |
15 | 6bk8:2 | 135 | 45 | 0.2163 | 0.3333 | 1.0000 | 2.50e-17 | |
16 | 5y88:F | 82 | 43 | 0.2067 | 0.5244 | 1.0000 | 3.24e-16 | |
17 | 3jb9:P | 111 | 44 | 0.2067 | 0.3874 | 0.9773 | 1.51e-14 |