acgaaucucuuugccuuuuggcuuagaucaaguguaguaucuguucaguguaacaacuaaugaccucagaggcucauauu
uguuacaauacacauuuuuuggcacccaaaauaggacgggaagagacuuuuaaagugagacgucgcgacccucgcaggag
ucguucuugacuuuuuggucgcuugauguuucucucuucccguuc
The query sequence (length=205) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6j6n:L | 205 | 205 | 1.0000 | 1.0000 | 1.0000 | 2.80e-106 | |
2 | 6j6q:L | 210 | 210 | 1.0000 | 0.9762 | 0.9762 | 4.73e-99 | |
3 | 6j6h:L | 209 | 210 | 0.9951 | 0.9761 | 0.9714 | 2.20e-97 | |
4 | 6j6g:L | 208 | 209 | 0.9854 | 0.9712 | 0.9665 | 3.68e-95 | |
5 | 7b9v:2 | 196 | 213 | 0.8927 | 0.9337 | 0.8592 | 2.34e-52 | |
6 | 5gmk:L | 127 | 106 | 0.4927 | 0.7953 | 0.9528 | 8.55e-42 | |
7 | 5lj3:Z | 171 | 205 | 0.8195 | 0.9825 | 0.8195 | 1.44e-34 | 5lj5:Z |
8 | 5mq0:2 | 155 | 79 | 0.3512 | 0.4645 | 0.9114 | 6.80e-23 | |
9 | 7dco:H | 169 | 85 | 0.3659 | 0.4438 | 0.8824 | 4.09e-20 | |
10 | 5lqw:2 | 81 | 81 | 0.3512 | 0.8889 | 0.8889 | 1.47e-19 | |
11 | 6bk8:2 | 135 | 56 | 0.2634 | 0.4000 | 0.9643 | 1.47e-19 | |
12 | 6exn:2 | 136 | 53 | 0.2488 | 0.3750 | 0.9623 | 1.90e-18 | |
13 | 5wsg:L | 91 | 46 | 0.2244 | 0.5055 | 1.0000 | 6.85e-18 | 5ylz:F |
14 | 5mps:2 | 49 | 46 | 0.2244 | 0.9388 | 1.0000 | 6.85e-18 | |
15 | 5gm6:L | 66 | 46 | 0.2244 | 0.6970 | 1.0000 | 6.85e-18 | |
16 | 5y88:F | 82 | 43 | 0.2098 | 0.5244 | 1.0000 | 3.19e-16 | |
17 | 3jb9:P | 111 | 39 | 0.1902 | 0.3514 | 1.0000 | 5.33e-14 |