accuuaagauaucagaggaaaguccuacugaucaaacaugcgcuuccaauaguagaaggacguuaagcauuuaucauuga
acuguucauugaagucauugaugcaaacuccuuggucacacacacauacggcgcggaaggcguguuugcugacguuucca
uucccuuguuucaaucauugguuaaacugauuuuuggggcccuuuguuucuucugccuggagaaguuugacaccaaauuc
aaauugguguuaggggagcuggggccuuucaaaaaaauuuuggaaggucuugguaggaacggguggaucuuauaauuuuu
gauuuau
The query sequence (length=327) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8w2o:R | 327 | 327 | 1.0000 | 1.0000 | 1.0000 | 7.02e-174 | |
2 | 6n7x:R | 308 | 324 | 0.9388 | 0.9968 | 0.9475 | 7.37e-139 | |
3 | 5zwn:P | 480 | 289 | 0.8257 | 0.5625 | 0.9343 | 1.64e-115 | |
4 | 5zwn:P | 480 | 53 | 0.1621 | 0.1104 | 1.0000 | 1.45e-21 | |
5 | 6n7r:R | 558 | 191 | 0.5657 | 0.3315 | 0.9686 | 1.32e-86 | |
6 | 6n7r:R | 558 | 95 | 0.2905 | 0.1703 | 1.0000 | 6.52e-45 | |
7 | 6n7r:R | 558 | 55 | 0.1682 | 0.0986 | 1.0000 | 1.12e-22 | |
8 | 6n7p:R | 558 | 191 | 0.5627 | 0.3297 | 0.9634 | 6.16e-85 | 7oqc:1, 7oqe:1 |
9 | 6n7p:R | 558 | 95 | 0.2905 | 0.1703 | 1.0000 | 6.52e-45 | 7oqc:1, 7oqe:1 |
10 | 6n7p:R | 558 | 55 | 0.1682 | 0.0986 | 1.0000 | 1.12e-22 | 7oqc:1, 7oqe:1 |
11 | 6g90:1 | 327 | 281 | 0.7217 | 0.7217 | 0.8399 | 1.77e-60 |