aauuucuacuguuguagaugagaagucauuuaauaaggcca
The query sequence (length=41) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6gtg:B | 41 | 41 | 1.0000 | 1.0000 | 1.0000 | 5.14e-16 | |
| 2 | 5mga:B | 40 | 40 | 0.9756 | 1.0000 | 1.0000 | 1.85e-15 | |
| 3 | 5kk5:B | 40 | 40 | 0.9512 | 0.9750 | 0.9750 | 8.60e-14 | |
| 4 | 6gte:B | 29 | 29 | 0.7073 | 1.0000 | 1.0000 | 2.41e-09 | 6gtf:B |
| 5 | 6gtc:B | 28 | 28 | 0.6829 | 1.0000 | 1.0000 | 8.67e-09 | 6gtd:B |
umich.edu