aauuucuacucuuguagaugugauaaguggaaugccaug
The query sequence (length=39) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8sfo:B | 39 | 39 | 1.0000 | 1.0000 | 1.0000 | 6.07e-15 | 8sfp:B, 8sfq:B, 8sfr:B |
| 2 | 8sfn:B | 36 | 36 | 0.9231 | 1.0000 | 1.0000 | 2.83e-13 | |
| 3 | 8sfl:B | 34 | 34 | 0.8718 | 1.0000 | 1.0000 | 3.66e-12 | |
| 4 | 8sfj:B | 29 | 29 | 0.7436 | 1.0000 | 1.0000 | 2.20e-09 | |
| 5 | 8sfi:B | 28 | 28 | 0.7179 | 1.0000 | 1.0000 | 7.91e-09 |
umich.edu