aauacagagaucagcaguuccccugcauaaggaugaaccguguuu
The query sequence (length=45) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 3jcm:D | 45 | 45 | 1.0000 | 1.0000 | 1.0000 | 3.61e-18 | |
2 | 5gan:W | 80 | 46 | 1.0000 | 0.5625 | 0.9783 | 1.68e-16 | |
3 | 5nrl:6 | 95 | 41 | 0.9111 | 0.4316 | 1.0000 | 6.04e-16 | |
4 | 5gap:W | 56 | 41 | 0.9111 | 0.7321 | 1.0000 | 6.04e-16 | |
5 | 5zwm:F | 99 | 41 | 0.8889 | 0.4040 | 0.9756 | 1.01e-13 | 5zwo:F |
6 | 5y88:D | 101 | 48 | 0.9778 | 0.4356 | 0.9167 | 4.70e-12 | |
7 | 5tf6:B | 71 | 48 | 0.9778 | 0.6197 | 0.9167 | 4.70e-12 | |
8 | 5mps:6 | 99 | 48 | 0.9778 | 0.4444 | 0.9167 | 4.70e-12 | 5mq0:6 |
9 | 5lj3:V | 97 | 48 | 0.9778 | 0.4536 | 0.9167 | 4.70e-12 | 5lj5:V |
10 | 7dco:F | 103 | 48 | 0.9778 | 0.4272 | 0.9167 | 4.70e-12 | 5gm6:E, 5gmk:E, 6j6g:E, 6j6h:E, 6j6n:E, 6j6q:E, 5wsg:E, 5ylz:D |
11 | 7b9v:6 | 102 | 48 | 0.9778 | 0.4314 | 0.9167 | 4.70e-12 | 6bk8:6, 6exn:6, 5lqw:6 |