BioLiP

>rna
aaguguaguaucuguucuuaucaguuuaauaucug

The query sequence (length=35) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	5z56:H	136	35	1.0000	0.2574	1.0000	8.73e-13	5z57:H, 5z58:H
2	6y50:2	50	35	1.0000	0.7000	1.0000	8.73e-13
3	8r09:2	98	35	1.0000	0.3571	1.0000	8.73e-13	8r0b:2, 8rm5:2
4	8r08:2	97	35	1.0000	0.3608	1.0000	8.73e-13	8r0a:2
5	8qxd:2	97	35	1.0000	0.3608	1.0000	8.73e-13
6	7qtt:f	76	35	1.0000	0.4605	1.0000	8.73e-13
7	8qo9:2	98	35	1.0000	0.3571	1.0000	8.73e-13	8qzs:2
8	7q4o:2	35	35	1.0000	1.0000	1.0000	8.73e-13
9	8i0r:H	167	35	1.0000	0.2096	1.0000	8.73e-13	8i0s:H, 8i0t:H, 8i0u:H
10	8i0p:H	165	35	1.0000	0.2121	1.0000	8.73e-13
11	7evo:H	148	35	1.0000	0.2365	1.0000	8.73e-13	8hk1:H, 6y5q:2
12	8ch6:f	137	35	1.0000	0.2555	1.0000	8.73e-13
13	7abi:2	164	35	1.0000	0.2134	1.0000	8.73e-13
14	7abh:2	37	35	1.0000	0.9459	1.0000	8.73e-13
15	6ah0:H	109	34	0.9714	0.3119	1.0000	3.14e-12	6ahd:H, 8h6e:2A, 8h6j:2A, 8h6k:2A, 8h6l:2A
16	6qx9:2	94	32	0.9143	0.3404	1.0000	4.06e-11
17	5mqf:2	140	32	0.9143	0.2286	1.0000	4.06e-11
18	9fmd:2	120	32	0.9143	0.2667	1.0000	4.06e-11	6qdv:2
19	8c6j:2	142	32	0.9143	0.2254	1.0000	4.06e-11
20	7vpx:H	130	30	0.8571	0.2308	1.0000	5.25e-10
21	7q4p:2	45	30	0.8571	0.6667	1.0000	5.25e-10
22	7onb:H	32	30	0.8571	0.9375	1.0000	5.25e-10

[Back]