aaggcgcguagcucaguagggagagcgccggcccgacacgccggaggucggggguucaaguccccccgcgccu
The query sequence (length=73) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8kd9:T | 73 | 73 | 1.0000 | 1.0000 | 1.0000 | 1.96e-33 | 8kd9:M, 8kd9:N, 8kd9:O, 8kd9:P, 8kda:T, 8kda:M, 8kda:N, 8kda:O, 8kda:P |
umich.edu