aagcagcuuuacagaucaauggcggagggaggucaacaucaagaacugugggccuuuuauugccuauagaacuuauaacg
aacaugguucuugccuuuuaccagaaccauccggguguugucuccauagaaacagguaaagcuguccguuacugugggcu
ugccauauuuuuuggaac
The query sequence (length=178) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7b9v:5 | 178 | 178 | 1.0000 | 1.0000 | 1.0000 | 2.45e-91 | |
2 | 7dco:B | 179 | 178 | 0.9775 | 0.9721 | 0.9775 | 1.48e-83 | 6j6g:D, 6j6h:D, 6j6n:D, 6j6q:D |
3 | 6exn:5 | 171 | 172 | 0.9494 | 0.9883 | 0.9826 | 6.90e-82 | |
4 | 5zwm:B | 175 | 178 | 0.9551 | 0.9714 | 0.9551 | 8.99e-76 | 5zwo:B |
5 | 5nrl:5 | 170 | 178 | 0.9551 | 1.0000 | 0.9551 | 8.99e-76 | |
6 | 5gam:U | 141 | 142 | 0.7528 | 0.9504 | 0.9437 | 9.25e-56 | 5gan:U, 5lj3:U, 5lj5:U, 5lqw:5, 5mps:5, 5mq0:5 |
7 | 6bk8:5 | 103 | 101 | 0.5449 | 0.9417 | 0.9604 | 9.45e-41 | |
8 | 5gm6:D | 117 | 100 | 0.5393 | 0.8205 | 0.9600 | 3.40e-40 | 5gmk:D, 5wsg:D, 5y88:B, 5ylz:B |
9 | 3jcm:F | 113 | 100 | 0.5169 | 0.8142 | 0.9200 | 2.06e-32 |