aagauagcccaagaaagagggcaauaaccagauauagccug
The query sequence (length=41) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5wlh:B | 43 | 41 | 1.0000 | 0.9535 | 1.0000 | 5.14e-16 | |
| 2 | 5w1i:B | 41 | 41 | 1.0000 | 1.0000 | 1.0000 | 5.14e-16 | |
| 3 | 5w1h:B | 42 | 41 | 1.0000 | 0.9762 | 1.0000 | 5.14e-16 | |
| 4 | 5w1i:D | 39 | 35 | 0.8537 | 0.8974 | 1.0000 | 1.11e-12 |
umich.edu