aacgugucgcgauggaugacuuggcuuccuauuucguugaagaacgcaguaaagugcgauaagugguaucaauugcagac
auucaauuaccgaaucuuugaacgcaaacggcgcaugggagaagcucgugucauccccgugcaugccauauucucagugu
cga
The query sequence (length=163) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8a3w:7 | 163 | 163 | 1.0000 | 1.0000 | 1.0000 | 4.83e-83 | |
2 | 8ovj:7 | 164 | 164 | 1.0000 | 0.9939 | 0.9939 | 2.25e-81 | |
3 | 8rxh:L7 | 166 | 165 | 1.0000 | 0.9819 | 0.9879 | 2.91e-80 | 8rxx:L7 |
4 | 6az3:7 | 163 | 165 | 0.9877 | 0.9877 | 0.9758 | 2.26e-76 | |
5 | 8a98:7 | 160 | 163 | 0.9755 | 0.9938 | 0.9755 | 2.93e-75 | |
6 | 5t2a:C | 162 | 164 | 0.9448 | 0.9506 | 0.9390 | 8.25e-66 | |
7 | 8ove:BC | 160 | 163 | 0.9387 | 0.9563 | 0.9387 | 2.97e-65 | |
8 | 3jcs:7 | 154 | 163 | 0.9448 | 1.0000 | 0.9448 | 2.97e-65 | |
9 | 8ova:BC | 160 | 164 | 0.9325 | 0.9500 | 0.9268 | 6.42e-62 | |
10 | 4v8m:BC | 169 | 169 | 0.9448 | 0.9112 | 0.9112 | 3.87e-59 | |
11 | 5t5h:C | 147 | 163 | 0.8896 | 0.9864 | 0.8896 | 5.07e-48 |