aacgugucgcgauggaugacuuggcuuccuauucguugaagaacgcaguaaagugcgauaagugguaucaauugcagaaa
uuaccaaucuuugaacgcaaacggcgcaugggagaagcuugucauccccgugcaugccauauucucagugucga
The query sequence (length=154) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 3jcs:7 | 154 | 154 | 1.0000 | 1.0000 | 1.0000 | 4.56e-78 | |
2 | 8a98:7 | 160 | 160 | 0.9935 | 0.9563 | 0.9563 | 4.62e-68 | |
3 | 8a3w:7 | 163 | 163 | 1.0000 | 0.9448 | 0.9448 | 2.78e-65 | |
4 | 8ovj:7 | 164 | 164 | 1.0000 | 0.9390 | 0.9390 | 3.60e-64 | |
5 | 8rxh:L7 | 166 | 165 | 1.0000 | 0.9277 | 0.9333 | 1.67e-62 | 8rxx:L7 |
6 | 8ova:BC | 160 | 159 | 0.9675 | 0.9313 | 0.9371 | 1.67e-62 | |
7 | 8ove:BC | 160 | 160 | 0.9610 | 0.9250 | 0.9250 | 3.62e-59 | |
8 | 6az3:7 | 163 | 165 | 0.9870 | 0.9325 | 0.9212 | 1.30e-58 | |
9 | 5t2a:C | 162 | 163 | 0.9610 | 0.9136 | 0.9080 | 1.01e-54 | |
10 | 5t5h:C | 147 | 156 | 0.9286 | 0.9728 | 0.9167 | 3.65e-54 | |
11 | 4v8m:BC | 169 | 169 | 0.9740 | 0.8876 | 0.8876 | 2.84e-50 |