BioLiP

>rna
aacgcagcuagcugcgagaauuaaugugaauugcaggacacauugaucaucgacacuu

The query sequence (length=58) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	6xa1:L8	155	58	1.0000	0.3742	1.0000	3.17e-25
2	8q7z:B8	157	58	1.0000	0.3694	1.0000	3.17e-25	8q87:B8
3	6lsr:8	155	58	1.0000	0.3742	1.0000	3.17e-25
4	8inf:8	154	58	1.0000	0.3766	1.0000	3.17e-25
5	8ine:8	155	58	1.0000	0.3742	1.0000	3.17e-25	8ir1:8, 8ir3:8
6	9fpz:8	58	58	1.0000	1.0000	1.0000	3.17e-25	9fq0:8, 8ony:8, 6sxo:L8
7	8fkz:L1	154	58	1.0000	0.3766	1.0000	3.17e-25	8fl2:L1, 8fl3:L1, 8fl4:L1, 8fl6:L1, 8fl7:L1, 8fl9:L1, 8fla:L1, 8flb:L1, 8flc:L1, 8fld:L1, 8fle:L1, 8flf:L1
8	8fky:L1	155	58	1.0000	0.3742	1.0000	3.17e-25
9	8fkr:L1	154	58	1.0000	0.3766	1.0000	3.17e-25
10	8fkp:L1	152	58	1.0000	0.3816	1.0000	3.17e-25	8fks:L1, 8fkt:L1, 8fku:L1, 8fkv:L1, 8fkw:L1, 8fkx:L1
11	5aj0:A3	157	58	1.0000	0.3694	1.0000	3.17e-25	4d5y:3, 4d67:3, 6gz3:A3, 6gz4:A3, 6gz5:A3, 6ole:D, 6olf:D, 6olg:A3, 6oli:D, 6olz:A3, 6om0:D, 6om7:D, 7qgg:D, 6swa:r, 4ujc:A3, 4ujd:A3, 4uje:A3, 4v6x:A8, 6w6l:D
12	7a01:h2	156	58	1.0000	0.3718	1.0000	3.17e-25	7bhp:L8, 8btk:B8, 7cpu:L8, 7cpv:L8, 9f1b:B8, 9f1c:B8, 9f1d:B8, 7f5s:L8, 6frk:8, 6ftg:w, 6fti:w, 6ftj:w, 8g5y:L8, 8g5z:L8, 8g60:L8, 8g61:L8, 8g6j:L8, 8glp:L8, 8idt:8, 8idy:8, 8ie3:8, 8ifd:1C, 8ife:1C, 8ink:8, 6ip5:1C, 6ip6:1C, 6ip8:1C, 8ipd:8, 8ipx:8, 8ipy:8, 3j7o:8, 3j7p:8, 3j7q:8, 3j7r:8, 3j92:8, 3jag:8, 3jah:8, 3jai:8, 3jaj:8, 3jan:8, 8jdj:F, 8jdk:F, 8jdl:F, 8jdm:F, 8k2c:L8, 5lks:L8, 6lqm:8, 6lss:8, 7ls1:C2, 7ls2:C2, 6lu8:8, 7nfx:8, 7nwi:8, 7o7y:B8, 7o7z:B8, 7o80:B8, 7o81:B8, 7obr:8, 8p2k:B8, 8qoi:L8, 7qvp:L1, 7qvp:L8, 7qwq:8, 7qwr:8, 7qws:8, 6qzp:L8, 6r6p:8, 8rjb:v, 8rjc:v, 8rjd:v, 8scb:8, 5t2c:C, 7tm3:v, 7toq:A58S, 7tut:v, 4ug0:L8, 7xnx:L3, 7xny:L3, 8xsx:L8, 8xsy:L8, 8xsz:L8, 6y0g:L8, 8y0w:L8, 8y0x:L8, 6y2l:L8, 6y57:L8, 6y6x:L8, 8yoo:L8, 8yop:L8, 6z6l:L8, 6z6m:L8, 6z6n:L8, 7zjw:L8, 7zjx:L8, 6zm7:L8, 6zme:L8, 6zmi:L8, 6zmo:L8, 6zvk:h2
13	8fkq:L1	150	58	0.9655	0.3733	0.9655	2.47e-21
14	7ow7:C	148	58	0.9483	0.3716	0.9483	4.13e-19
15	8a3d:C	148	58	0.9483	0.3716	0.9483	4.13e-19	8ohd:8, 8oj0:8, 8oj5:8, 8oj8:8
16	8bf9:8	98	58	0.9310	0.5510	0.9310	1.92e-17
17	7ucj:8	150	58	0.9138	0.3533	0.9138	3.22e-15
18	7oyd:8	144	58	0.9138	0.3681	0.9138	3.22e-15
19	8b5l:8	151	58	0.9138	0.3510	0.9138	3.22e-15	8b6c:8, 9bdl:A58S, 9bdn:A58S, 9bdp:A58S, 8bhf:C2, 8bpo:C1, 6d90:8, 6d9j:8, 6hcf:82, 6hcj:81, 6hcm:82, 6hcq:81, 5lzs:8, 5lzt:8, 5lzu:8, 5lzv:8, 5lzw:8, 5lzx:8, 5lzy:8, 5lzz:8, 7mdz:8, 6mtb:8, 6mtc:8, 6mtd:8, 6mte:8, 7nwg:81, 7nwh:8, 6p5i:8, 6p5j:8, 6p5k:8, 6p5n:8, 6r5q:8, 6r6g:8, 6r7q:8, 6sgc:84, 6t59:84, 7tor:A58S, 7uck:8
20	8qfd:8	144	37	0.6379	0.2569	1.0000	1.50e-13

[Back]