BioLiP

>rna
aacgauacagagaagauuagcauggccccugcgcaaggaugacauucgugaagcguauuu

The query sequence (length=60) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	8rm5:6	64	60	1.0000	0.9375	1.0000	2.57e-26
2	8r09:6	65	60	1.0000	0.9231	1.0000	2.57e-26	8r0b:6
3	8h6k:6A	60	60	1.0000	1.0000	1.0000	2.57e-26
4	6ahd:F	94	60	1.0000	0.6383	1.0000	2.57e-26	8qo9:6
5	8h6e:6A	59	59	0.9833	1.0000	1.0000	9.26e-26	8h6l:6A, 8qzs:6
6	5o9z:6	90	56	0.9333	0.6222	1.0000	4.31e-24
7	5z56:F	93	58	0.9333	0.6022	0.9655	2.59e-21	5z57:F, 5z58:F
8	8h6j:6A	54	51	0.8333	0.9259	0.9804	1.21e-19
9	8ch6:d	93	58	0.9167	0.5914	0.9483	1.21e-19	7qtt:d
10	8r0a:6	59	56	0.8833	0.8983	0.9464	5.61e-18
11	6zym:6	79	44	0.7333	0.5570	1.0000	2.02e-17
12	8qpa:6	47	44	0.7333	0.9362	1.0000	2.02e-17
13	8qoz:6	48	44	0.7333	0.9167	1.0000	2.02e-17	8qpb:6
14	8q7n:6	78	44	0.7333	0.5641	1.0000	2.02e-17
15	5mqf:6	89	44	0.7333	0.4944	1.0000	2.02e-17
16	6ff4:6	95	44	0.7333	0.4632	1.0000	2.02e-17	6ff7:6, 8i0p:F
17	8c6j:6	97	44	0.7333	0.4536	1.0000	2.02e-17	9fmd:6, 8i0r:F, 8i0s:F, 8i0t:F, 8i0u:F, 8i0v:F, 8i0w:F, 6icz:F, 6id0:F, 6id1:F, 6qdv:6, 8ro2:6, 7w59:F, 7w5a:F, 7w5b:F, 5xjc:F, 5yzg:F
18	8qpe:6	43	43	0.7167	1.0000	1.0000	7.26e-17
19	6ah0:F	69	53	0.8333	0.7246	0.9434	7.26e-17
20	8ro1:6	101	44	0.7167	0.4257	0.9773	9.39e-16
21	8ro0:6	90	44	0.7167	0.4778	0.9773	9.39e-16
22	6qx9:6	53	51	0.8000	0.9057	0.9412	9.39e-16	8qxd:6, 8r08:6
23	3jb9:N	90	44	0.7167	0.4778	0.9773	9.39e-16
24	8qpk:6	43	38	0.6333	0.8837	1.0000	4.37e-14
25	6qw6:6	42	37	0.6000	0.8571	0.9730	7.31e-12
26	8qp8:6	37	34	0.5500	0.8919	0.9706	3.40e-10	8qp9:6

[Back]