aacaagcgaaugagucauucauccuaagucugcau
The query sequence (length=35) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7vg2:D | 36 | 35 | 1.0000 | 0.9722 | 1.0000 | 8.73e-13 | |
2 | 7vg2:C | 35 | 35 | 1.0000 | 1.0000 | 1.0000 | 8.73e-13 | |
3 | 7vg3:D | 32 | 29 | 0.8286 | 0.9062 | 1.0000 | 1.89e-09 | |
4 | 7vg3:C | 30 | 29 | 0.8286 | 0.9667 | 1.0000 | 1.89e-09 |