aaaagagugaacgagaggcucuuccaacuuagguugaaagagcacaggcugagacauucguaaggccgaaagaccggacg
cacccugggauuuccccaguccccggaacugcauagcggaugccaguugauuaucagauaagccagggggaacaaucacc
ucucuguaucagagagaguuuuac
The query sequence (length=184) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8csz:C | 184 | 184 | 1.0000 | 1.0000 | 1.0000 | 1.17e-94 | 8ctl:C, 7utn:C |
| 2 | 7xht:B | 179 | 148 | 0.7880 | 0.8101 | 0.9797 | 1.57e-68 |
umich.edu