aaaaaggacggugagcuucgugacaauuaa
The query sequence (length=30) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8rcs:V2 | 59 | 30 | 1.0000 | 0.5085 | 1.0000 | 3.79e-10 | 8rct:V2 |
| 2 | 8r3v:V2 | 64 | 30 | 1.0000 | 0.4688 | 1.0000 | 3.79e-10 | 8rcl:V2 |
| 3 | 8peg:V | 30 | 30 | 1.0000 | 1.0000 | 1.0000 | 3.79e-10 |
umich.edu