ttcaactgctttcgcatcccaactacttttcctcacacttgtactcca
The query sequence (length=48) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6rui:T | 48 | 48 | 1.0000 | 1.0000 | 1.0000 | 4.94e-21 | |
| 2 | 6rrd:U | 48 | 48 | 0.9583 | 0.9583 | 0.9583 | 1.07e-17 | |
| 3 | 6rui:U | 46 | 48 | 0.9583 | 1.0000 | 0.9583 | 3.84e-17 | |
| 4 | 6rrd:T | 51 | 51 | 1.0000 | 0.9412 | 0.9412 | 1.38e-16 | |
| 5 | 6ruo:T | 50 | 32 | 0.6667 | 0.6400 | 1.0000 | 3.87e-12 | 6rwe:T |
| 6 | 6rql:U | 42 | 32 | 0.6667 | 0.7619 | 1.0000 | 3.87e-12 | |
| 7 | 6rql:T | 42 | 32 | 0.6667 | 0.7619 | 1.0000 | 3.87e-12 | |
| 8 | 6rqh:U | 39 | 32 | 0.6667 | 0.8205 | 1.0000 | 3.87e-12 | |
| 9 | 6rqh:T | 39 | 32 | 0.6667 | 0.8205 | 1.0000 | 3.87e-12 | |
| 10 | 6ruo:U | 43 | 45 | 0.8542 | 0.9535 | 0.9111 | 1.39e-11 | |
| 11 | 6rwe:U | 45 | 30 | 0.6250 | 0.6667 | 1.0000 | 5.01e-11 |
umich.edu